2.1.

Antibodies and Reagents

Monoclonal mouse Rab4 and Rab11 antibodies were purchased from BD Transduction Laboratories (Lexington, Kentucky). Polyclonal rabbit anti-GFP, polyclonal rabbit anti-Rab4, and polyclonal goat anti-Rab11 and normal mouse, rabbit, and goat antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, California). Alexa-546, Alexa-555, and Alexa-633 protein labeling kits were obtained from Molecular Probes (Eugene, Oregon). Cycloheximide and other obtained reagents were obtained from Sigma (St. Louis, MO).

2.2.

Cell Culture and Transfection

Human embryonic kidney (HEK) 293 cells from ATCC (Manassas, Virginia) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen) containing $4.5\mathrm{g}∕\mathrm{L}$ glucose, 10% fetal bovine serum (FBS), $2\mathrm{mM}$ $L$ -glutamine, and $1\mathrm{mM}$ sodium pyruvate. Human ${\mathrm{AT}}_1\mathrm{R}$ -EGFP (enhanced green fluorescence protein) or its empty vector pEGFP-N1²⁶ was transfected into HEK 293 cells using Lipofectamine 2000 transfection reagents (Invitrogen), as described previously,²⁷ according to the manufacturer’s instructions. Transfectants were selected with G418. Stable transfectants were tested and confirmed by immunoblotting with anti-GFP and anti- ${\mathrm{AT}}_1\mathrm{R}$ antibodies, flow cytometry, and radioligand binding assay (data not shown). The EGFP tag did not interrupt the function of ${\mathrm{AT}}_1\mathrm{R}$ , determined by a dose-dependent Ang II–induced phosphorylation of extracellular signal-regulated kinase (ERK1/2) (data not shown). The stably transfected cells expressing human ${\mathrm{AT}}_1\mathrm{R}$ -EGFP were designated in this study as ${\mathrm{AT}}_1\mathrm{R}$ HEK 293 cells.

2.3.

siRNA and Transfection

Specific Rab4 (AATGCAGGAACTGGCAAATCT), Rab11 (AAGAGTAATCTCCTGTCTCGA), and negative control (AATTCTCCGAACGTGTCACGT) siRNA duplexes were purchased from Qiagen (Valencia, California). ${\mathrm{AT}}_1\mathrm{R}$ HEK 293 cells were transfected with these siRNA using Lipofectamine 2000 transfection reagents (Invitrogen) according to the manufacturer’s instructions. After siRNA treatment for $36\mathrm{h}$ , cells were split into three portions. A small portion of cells was used to check Rab4 and Rab11 levels by immunoblotting with anti-Rab4 and Rab11 antibodies [Fig. 1b ]. The largest portion of cells was used for immunoprecipitation experiments [Fig. 1c]. The third portion of the cells was dispersed in DMEM containing 10% FBS and placed ( $5\times {10}^4$ cells per well) on six-well plates with collagen I-coated coverslips; the attached cells were gently washed and fixed with 4% formaldehyde in PBS for observation of ${\mathrm{AT}}_1\mathrm{R}$ -EGFP fluorescence at the indicated recycling times after the cells have been treated with Ang II for $15\min$ (Fig. 2 ).

Fig. 1

Co-immunoprecipitation of ${\mathrm{AT}}_1\mathrm{R}$ , Rab4, and Rab11. (a) ${\mathrm{AT}}_1\mathrm{R}$ HEK 293 cells treated without (lane 1) or with Ang II ( $100\mathrm{nM}$ , $15\min$ ) were co-immunoprecipitated following the procedure described in Sec. 2 for recovery of 0 (lane 2), 15 (lane 3), 45 (lane 4), 120 (lane 5), and 180 (lane 6) min, respectively. Cell homogenates were incubated with anti-GFP IgG $\left(5\mu \mathrm{g}\right)$ , and precipitated proteins were separated by SDS-PAGE and immunoblotted with Rab4 or Rab11 mAbs, as indicated. (b) $30\mu \mathrm{g}$ protein homogenates from ${\mathrm{AT}}_1\mathrm{HEK}$ 293 cells untreated (lane 1) or treated with Rab4 (lane 2) or Rab11 (lane 3) siRNA and negative control siRNAs (lane 4) were immunoblotted with antibodies against Rab4, Rab11, or actin, as indicated. (c) As in (a), Rab4 siRNA-transfected cells were treated without (lane 1) or with Ang II ( $100\mathrm{nM}$ , $15\min$ ) following recovery of 0 (lane 2), 15 (lane 3), 45 (lane 4), 120 (lane 5), and 180 (lane 6) min, respectively. Cell homogenates were precipitated with anti-GFP IgG $\left(5\mu \mathrm{g}\right)$ and immunoblotted with Rab11 mAb. (d) As in (c), Rab11 siRNA-trasnfected cells were treated without (lane 1) or with Ang II ( $100\mathrm{nM}$ , $15\min$ ) following recovery of 0 (lane 2), 15 (lane 3), 45 (lane 4), 120 (lane 5), and 180 (lane 6) min, respectively. Cell homogenates were precipitated with anti-GFP IgG $\left(5\mu \mathrm{g}\right)$ and immunoblotted with Rab4 mAb.

Fig. 2

Interruption of ${\mathrm{AT}}_1\mathrm{R}$ recycling with either Rab4 or Rab11 gene silencing. ${\mathrm{AT}}_1\mathrm{R}$ HEK 293 cells were transfected without (solid line) or with either Rab4 siRNA (broken line) or Rab11 siRNA (dashed line) for $36\mathrm{h}$ . Then, cells were treated as described in Sec. 2. The amount of cell surface ${\mathrm{AT}}_1\mathrm{R}$ was assessed by the average intensity of ${\mathrm{AT}}_1\mathrm{R}$ fluorescence at the plasma membrane using Metamorph 7.0. Data are mean $\pm$ SE, $n=4–6$ .

2.4.

Immunoprecipitation and Immunoblotting

Vehicle- or siRNA-transfected ${\mathrm{AT}}_1\mathrm{R}$ HEK 293 cells were homogenized by freeze-thaw $(5\times )$ in a lysis buffer ( $20\mathrm{mM}$ $\mathrm{Tris}\cdot \mathrm{HCl}$ , pH $8.0∕1\mathrm{mM}$ $\mathrm{EDTA}∕1\mathrm{mM}$ ${\mathrm{NaN}}_3∕2\mathrm{mM}$ $\mathrm{DTT}∕0.25\mathrm{M}$ sucrose), with $0.5\mathrm{mM}$ 4-(2-aminoethyl)benzenesulfonyl fluoride (AEBSF), $0.5\mathrm{mM}$ benzamidine hydrochloride, and protease inhibitors (soybean and lima bean trypsin inhibitors, leupeptin, and aprotinin, each $1\mu \mathrm{g}∕\mathrm{ml}$ ). The homogenates $\left(1\mathrm{mg}\right)$ were incubated (rocking, $4°\mathrm{C}$ , $4\mathrm{h}$ ) with $5\mu \mathrm{g}$ of anti-GFP rabbit IgG, $4\mu \mathrm{g}$ of anti-Rab4 rabbit IgG, or $6\mu \mathrm{g}$ of anti-Rab11 goat IgG in $0.5\mathrm{ml}$ of the lysis buffer with $20\mu \mathrm{M}$ ${\mathrm{MgCl}}_2$ , 0.1% ovalbumin, $0.5\mathrm{mM}$ AEBSF, 0.5% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate. Controls were normal rabbit, mouse, or goat IgG (data not shown). After adding $60\mu \mathrm{l}$ of a 50% slurry of protein G-Sepharose CL-4B (Amersham Pharmacia, Uppsala, Sweden) in PBS and incubation at $4°\mathrm{C}$ overnight, the beads were washed three times with $1\mathrm{ml}$ of ice-cold PBS, containing $0.5\mathrm{mM}$ AEBSF. Proteins bound to beads were eluted in $80\mu \mathrm{l}$ of loading buffer at $65°\mathrm{C}$ for $10\min$ , separated by SDS/PAGE (sodium dodecyl sulfate/polyacrylamide gel electrophoresis) in 4 to 12% gradient gels, and transferred onto nitrocellulose membrane for incubation with mAb against Rab4 or Rab11 and rabbit anti-GFP, followed by appropriate horseradish peroxidase-conjugated secondary antibodies and detection using Super Signal Chemiluminescent substrate (Pierce, Rockford, IL).

2.5.

Confocal Immunofluorescence Microscopy

${\mathrm{AT}}_1\mathrm{R}$ HEK 293 cells were fixed with 4% paraformaldehyde in PBS for $20\min$ at room temperature. After washing with PBS, the fixed cells on coverslips were incubated overnight at $4°\mathrm{C}$ with Alexa Fluor 633-conjugated monoclonal mouse Rab4 antibody ( $2\mu \mathrm{g}∕\mathrm{ml}$ ; Alexa Fluor 633 protein labeling kit, Molecular Probe, Eugene, Oregon) or Alexa Fluor 546-conjugated polyclonal goat Rab11 antibody ( $5\mu \mathrm{g}∕\mathrm{ml}$ ; Alexa Fluor 546 protein labeling kit, Molecular Probe). The coverslips were mounted in SlowFade mounting medium (Molecular Probe) and sealed onto glass slides. Samples were imaged using an Olympus Fluoview FV300 laser scanning confocal microscope equipped with a $60\times ∕1.4$ NA objective.

2.6.

Receptor Recycling Assays

Vehicle- or siRNA-transfected ${\mathrm{AT}}_1\mathrm{R}$ HEK 293 cells were treated with vehicle or $100\mathrm{nM}$ Ang II for $15\min$ at $37°\mathrm{C}$ and then placed on ice. After washing three times with ice-cold, serum-free DMEM medium, the cells were recultured in complete culture medium containing $20\mu \mathrm{g}∕\mathrm{ml}$ cycloheximide and reincubated at $37°\mathrm{C}$ (with 5% ${\mathrm{CO}}_2$ ) for the indicated time from 0 to $180\min$ . The cells were then fixed with 4% paraformaldehyde for fluorescence microscopy. The density of ${\mathrm{AT}}_1\mathrm{R}$ at the cell surface was determined by quantifying cell surface fluorescence using MetaMorph 7.0 (Molecular Devices, Downington, Pennsylvania).²⁷ After identifying the plasma membrane, regions of interest (ROIs) were drawn manually in $300\times$ zoomed-in images. The background was subtracted from each image, and then the images were thresholded to identify specific EGFP fluorescence for ${\mathrm{AT}}_1\mathrm{R}$ at the plasma membrane. Receptor recycling was defined as the recovery of cell-surface receptors following the removal of Ang II, compared with the cell-surface expression of receptors in cells that were not exposed to Ang II (vehicle-treated cells).

2.7.

FRET Microscopy and Data Processing

The fluorophore pairs used for FRET imaging in this study were ${\mathrm{AT}}_1\mathrm{R}$ -EGFP (as donor dipole) and Alexa Fluor 555 (as acceptor dipole) conjugated with Rab4 or Rab11 antibodies (Alexa Fluor 555 protein labeling kit, Molecular Probe). Seven images were acquired for each FRET analysis, as described,²³ with an Olympus Fluoview FV300 laser scanning confocal microscope equipped with a $60\times ∕1.4$ NA objective, Argon $\left(488\mathrm{nm}\right)$ and $\mathrm{HeNe}$ $\left(543\mathrm{nm}\right)$ laser, and emission filters $515∕50\mathrm{nm}$ and 590-nm long press (LP) filter. Either single-labeled donor or acceptor or double-labeled samples were acquired under the same conditions throughout the image collection. The uncorrected FRET images (uFRET) were acquired by donor excitation in the acceptor channel, which contained pure FRET (pFRET) and contaminations from both donor and acceptor spectral bleed-through (SBT). pFRET images were generated by employing a described algorithm²³ for pixel-by-pixel removal of donor and acceptor SBT on the basis of matched fluorescence levels between the double-labeled specimen and the single-labeled reference specimens.

ROIs were selected in the uFRET images.²³ In this study, we used image (e) (donor excitation in the donor channel of the double-labeled specimen) as the reference image for selection of ROIs to determine the plasma membrane, cytoplasm, and perinuclear compartments. Image g was acquired at acceptor excitation in the acceptor channel of the double-labeled specimen.

The percentage of energy transfer efficiency $(E\%)$ images was processed on a pixel-by-pixel basis by using the following equation:

2.8.

Statistical Analysis

Results are expressed as mean (M) $\pm$ standard error (SE), as indicated. Significant differences among groups were determined by factorial ANOVA and the Student-Newman-Keuls test. $P<0.05$ was considered statistically significant (SigmaStat 3.0, SPSS, Inc., Chicago).

3.1.

Subcellular Location of Human ${\mathit{AT}}_{\mathit{1}}R$ , Rab4, and Rab11

In HEK 293 cells under basal conditions, human ${\mathrm{AT}}_1\mathrm{R}$ tagged with EGFP was observed primarily at the plasma membrane [Fig. 3a ] but also in the intracellular membrane, perinuclear compartments, and cytoplasm [Fig. 3a], consistent with previous observations.^{22, 27}

Fig. 3

Subcellular distribution of the ${\mathrm{AT}}_1\mathrm{R}$ (a), Rab4 (b), and Rab11 (c) in ${\mathrm{AT}}_1\mathrm{R}$ HEK 293 cells. The ${\mathrm{AT}}_1\mathrm{R}$ , tagged with EGFP at its C-terminal, is mainly localized at the plasma membrane. Both Rab4 and Rab11 are scattered throughout the cytoplasm; portions of Rab11 reside in the perinuclear compartments. (d) Overlay of (a) ( ${\mathrm{AT}}_1\mathrm{R}$ -GFP, green) and (b) (Rab4, red); (e) overlay of (a) and (c) (Rab11, blue); (f) overlay of (a), (b), and (c). Bar, $10\mathrm{\mu }\mathrm{m}$ .

Endogenous Rab4 staining was observed in typical vesicles scattered throughout the cytoplasm, and very occasionally concentrated in the perinuclear compartments [Fig. 3b]. Endogenous Rab11 was scattered throughout the cytoplasm as well, but most often, Rab11 was observed to concentrate in the perinuclear areas [Fig. 3c]. Overall, Rab4 was more dispersed than Rab11 throughout the cytoplasm, but neither Rab4 nor Rab11 was observed at the plasma membrane. These observations are in agreement with studies using GFP-tagged Rab4 and Rab11.^{6, 22}

Minimal, if any, co-localization was observed between ${\mathrm{AT}}_1\mathrm{R}$ and Rab4 [Fig. 3d] or Rab11 [Fig. 3e]. Few co-localizations were observed among ${\mathrm{AT}}_1\mathrm{R}$ , Rab4, and Rab11 [Fig. 3f].

3.2.

Recycling Course of ${\mathit{AT}}_{\mathit{1}}R$

In this report, the cell surface ${\mathrm{AT}}_1\mathrm{R}$ at the basal state was set at 100%. As shown in Fig. 4 , the relative surface intensity of ${\mathrm{AT}}_1\mathrm{R}$ is $31.8\pm 5.3\%$ ( $n=33$ cells) when cells were treated with $100\mathrm{nM}$ Ang II for $15\min$ , a time considered as the start of recycling (time $0\min$ ); subsequent recycling of ${\mathrm{AT}}_1\mathrm{R}$ to the plasma membrane was quantified at the indicated time points after removing of Ang II. The membrane surface ${\mathrm{AT}}_1\mathrm{R}$ fluorescence intensity was directly related to recovery time $\left(t\right)$ : $0.895-0.58{\mathrm{e}}^{-\mathrm{t}∕23.8}$ , which followed a first-order exponential curve [Fig. 4a]. After $\sim 45\min$ , the cell surface ${\mathrm{AT}}_1\mathrm{R}$ reached slightly over 75% of its basal level, and close to 90% of its basal level at about $2\mathrm{h}$ , similar to that reported²² for the rat ${\mathrm{AT}}_{1\mathrm{A}}\mathrm{R}$ , but much slower than that^{14, 17} for class A GPCRs, e.g., ${\beta }_2\mathrm{AR}$ . However, only $\sim 90\%$ ${\mathrm{AT}}_1\mathrm{R}$ was expressed at the plasma membrane at steady state (Fig. 4), probably due to the lack of newly synthesized ${\mathrm{AT}}_1\mathrm{R}$ for replacement, implying that $\sim 10\%$ of ${\mathrm{AT}}_1\mathrm{Rs}$ were processed for degradation.

Fig. 4

Recycling of ${\mathrm{AT}}_1\mathrm{R}$ to the cell surface. ${\mathrm{AT}}_1\mathrm{R}$ HEK 293 cells were stimulated with Ang II ( $100\mathrm{nM}$ , $15\min$ ) and then were placed on ice. After thorough washing, the cells were incubated in complete culture medium containing $20\mu \mathrm{g}$ of cycloheximide at $37°\mathrm{C}$ in 5% ${\mathrm{CO}}_2$ for the indicated times. Then, cells were fixed with 4% paraformaldehyde, as described in Sec. 2. The amount of cell surface ${\mathrm{AT}}_1\mathrm{R}$ was assessed by the average intensity of ${\mathrm{AT}}_1\mathrm{R}$ fluorescence at the plasma membrane using Metamorph 7.0. Data are mean $\pm$ SE; the data were plotted with first-order exponential fit (a), second-order exponential fit (b), and second-order polynomial fit (c), respectively, using OriginLab 6.1.

For a first-order exponential fit of the data, the following values are obtained: $R^2$ is 0.9931, with two degrees of freedom, and an absolute of square of 0.00168; the values for a second-order exponential fit [Fig. 4b] are: $R^2$ is 0.5833, with one degree of freedom, and an absolute of square is 0.1014. The second-order polynomial curve is a poor fit [Fig. 4c]. These analyses show that ${\mathrm{AT}}_1\mathrm{R}$ recovery rate best fits a first-order exponential equation, consistent with a single recycling pathway for human ${\mathrm{AT}}_1\mathrm{R}$ .

In the following studies, for convenience, we divided the entire recycling course into early (from time 0 to $15\min$ ), middle (from $15\min$ to $45\min$ ), and late (over $45\min$ ) recycling stages.

3.3.

Role of Rab4 and Rab11 in the Early Stage of ${\mathit{AT}}_{\mathit{1}}R$ Recycling

FRET was not observed between ${\mathrm{AT}}_1\mathrm{R}$ and Rab4 or Rab11 during the basal state (data not shown), which is consistent with the absence of co-localization of ${\mathrm{AT}}_1\mathrm{R}$ with either Rab4 or Rab11 in the basal state (Fig. 3).

At the start of recycling (time 0), obvious FRET was observed in the cytoplasm between Rab4 and ${\mathrm{AT}}_1\mathrm{R}$ [Fig. 5a ], the efficiency of energy transfer $(E\%)$ was $28.3\pm 9.1\%$ ( $n=34$ cells), the estimated distance was $78.8\mathrm{\AA }$ (Table 1 ), but no FRET was observed between Rab11 and ${\mathrm{AT}}_1\mathrm{R}$ [Fig. 5b, Table 1]. The association of ${\mathrm{AT}}_1\mathrm{R}$ and Rab4, but not ${\mathrm{AT}}_1\mathrm{R}$ and Rab11 was also observed by immunoprecipitation [Fig. 1a, lane 2].

Fig. 5

FRET analysis of ${\mathrm{AT}}_1\mathrm{R}$ and Rab4 (a) or ${\mathrm{AT}}_1\mathrm{R}$ and Rab11 (b) at recycling time 0. As described in Sec. 2, regions of interest (ROIs) were drawn in image e, rectangles $(◻)$ indicate the plasma membrane, ovals $\left(\mathrm{O}\right)$ indicates cytoplasm, and freehand drawings indicate perinuclear compartments. The pFRET and $E\%$ images were processed by programs developed at the K. M. Keck Center for Cellular Imaging, University of Virginia (Charlottesville). Bar, $10\mu \mathrm{m}$ .

Table 1

Calculation of efficiency of energy transfer (E%) and molecular proximity (R) between AT1R and Rab4 or Rab11 during the entire AT1R recycling course. AT1R HEK 293 cells were treated and fixed as described in Sec. 2. AT1R -EGFP is the donor; the acceptor is Rab4 or Rab11. FRET analysis is described in Figs. 5, 6, 7, 8, 9. Data are mean±SE ; n , number of cells analyzed, Infin, infinity.

At time $15\min$ , FRET was obvious between Rab4 and ${\mathrm{AT}}_1\mathrm{R}$ in cytoplasm and perinuclear compartments, especially in vesicles in the cytoplasm [Fig. 6a ], the $E$ % was $23.4\pm 6.7\%$ ( $n=35$ cells) and $16.3\pm 5.3\%$ ( $n=35$ cells), respectively (Table 1). FRET was also observed between Rab11 and ${\mathrm{AT}}_1\mathrm{R}$ [Fig. 6b] in perinuclear compartments ( $14.9\pm 7.8\%$ , $n=29$ cells) and cytoplasm ( $11.6\pm 3.3$ , $n=29$ cells). No FRET was observed at the plasma membrane between ${\mathrm{AT}}_1\mathrm{R}$ with either Rab4 or Rab11 (Fig. 6). The association of Rab4 and Rab11 with ${\mathrm{AT}}_1\mathrm{R}$ was also observed by immunoprecipitation [Fig. 1a, lane 3]. These observations indicated that Rab4 played a major role(s) during the early recycling period; Rab11 could also play some role in this stage.

Fig. 6

FRET analysis of ${\mathrm{AT}}_1\mathrm{R}$ and Rab4 (a) or ${\mathrm{AT}}_1\mathrm{R}$ and Rab11 (b) at recycling time $15\min$ . As described in Sec. 2, ROIs were drawn in image e, rectangles $(◻)$ indicate the plasma membrane, ovals $\left(\mathrm{O}\right)$ indicate cytoplasm, and freehand drawings indicate perinuclear compartments. The pFRET and $E\%$ images were processed by programs developed at the K. M. Keck Center for Cellular Imaging, University of Virginia (Charlottesville). Bar, $10\mu \mathrm{m}$ .

3.4.

Role of Rab4 and Rab11 in the Middle Stage of ${\mathit{AT}}_{\mathit{1}}R$ Recycling

At time $45\min$ , FRET between Rab4 and ${\mathrm{AT}}_1\mathrm{R}$ in the cytoplasm minimally decreased ( $21.0\pm 2.1\%$ , $n=46$ cells), but increased in perinuclear compartments ( $34.5\pm 4.1\%$ , $n=46$ cells) [Fig. 7a ; Table 1], compared to the early recycling stage. In contrast, FRET between Rab11 and ${\mathrm{AT}}_1\mathrm{R}$ increased in both the cytoplasm ( $17.84\pm 2.2\%$ , $n=36$ cells) and perinuclear compartments ( $37.4\pm 6.5\%$ , $n=36$ cells) [Fig. 7b] compared to its early stage $(p<0.05)$ . At $45\min$ , no FRET was observed between ${\mathrm{AT}}_1\mathrm{R}$ and Rab4 or Rab11 at the plasma membrane [Fig. 7; Table 1). Of note, the calculated $E\%$ of Rab4 and ${\mathrm{AT}}_1\mathrm{R}$ ( $34.5\pm 4.1\%$ , $n=46$ cells) was similar to that of Rab11 and ${\mathrm{AT}}_1\mathrm{R}$ ( $37.4\pm 6.5\%$ , $n=36$ cells) $(p>0.05)$ ; both Rab4 and Rab11 were co-immunoprecipitated by the GFP antibody (for ${\mathrm{AT}}_1\mathrm{R}$ ) [Fig. 1a, lane 4] and vice versa (data not shown). Furthermore, gene knockdown of Rab4 by specific Rab4 siRNA disrupted the association of ${\mathrm{AT}}_1\mathrm{R}$ with Rab11 [Fig. 1c]; Rab11 gene knockdown also disrupted the association of Rab4 with ${\mathrm{AT}}_1\mathrm{R}$ [Fig. 1d]. All of these data indicated that Rab4 and Rab11 were in the same recycling endosomes for ${\mathrm{AT}}_1\mathrm{R}$ trafficking at this stage. Therefore, both Rab4 and Rab11 play important roles in ${\mathrm{AT}}_1\mathrm{R}$ trafficking during this period.

Fig. 7

FRET analysis of ${\mathrm{AT}}_1\mathrm{R}$ and Rab4 (a) or ${\mathrm{AT}}_1\mathrm{R}$ and Rab11 (b) at recycling time $45\min$ . As described in Sec. 2, ROIs were drawn in image e, rectangles $(◻)$ indicate the plasma membrane, ovals $\left(\mathrm{O}\right)$ indicate cytoplasm, and freehand drawings indicate perinuclear compartments. The pFRET and $E\%$ images were processed by programs developed at the K. M. Keck Center for Cellular Imaging, University of Virginia (Charlottesville). Bar, $10\mu \mathrm{m}$ .

3.5.

Role of Rab4 and Rab11 in the Late Stage of ${\mathit{AT}}_{\mathit{1}}R$ Recycling

At time $2\mathrm{h}$ , no FRET was observed between Rab4 and ${\mathrm{AT}}_1\mathrm{R}$ in the cytoplasm, perinuclear compartments, and the plasma membrane [Fig. 8a ], but obvious FRET was still observed between Rab11 and ${\mathrm{AT}}_1\mathrm{R}$ in the perinuclear compartments [Fig. 8b]. The remarkable observation in this late period is that FRET occurred at the plasma membrane between Rab11 and ${\mathrm{AT}}_1\mathrm{R}$ ( $14.6\pm 3.3\%$ , $n=26$ cells) [Fig. 8b; Table 1], indicating the importance of Rab11 in the late stage of ${\mathrm{AT}}_1\mathrm{R}$ recycling.

Fig. 8

FRET analysis of ${\mathrm{AT}}_1\mathrm{R}$ and Rab4 (a) or ${\mathrm{AT}}_1\mathrm{R}$ and Rab11 (b) at recycling time $2\mathrm{h}$ . As described in Sec. 2, ROIs were drawn in image e, rectangles $(◻)$ indicate the plasma membrane, ovals $\left(\mathrm{O}\right)$ indicate cytoplasm, and freehand drawings indicate perinuclear compartments. The pFRET and $E\%$ images were processed by programs developed at the K. M. Keck Center for Cellular Imaging, University of Virginia (Charlottesville). Bar, $10\mu \mathrm{m}$ .

At time $3\mathrm{h}$ , no FRET was observed between Rab4 or Rab11 and ${\mathrm{AT}}_1\mathrm{R}$ at the plasma membrane, cytoplasm, or perinuclear compartments (Fig. 9 ; Table 1), similar to that observed at the basal state (data not shown).

Fig. 9

FRET analysis of ${\mathrm{AT}}_1\mathrm{R}$ and Rab4 (a) or ${\mathrm{AT}}_1\mathrm{R}$ and Rab11 (b) at recycling time $3\mathrm{h}$ . As described in Sec. 2, ROIs were drawn in image e, rectangles $(◻)$ indicate the plasma membrane, ovals $\left(\mathrm{O}\right)$ indicate cytoplasm, and freehand drawings indicate perinuclear compartments. The pFRET and $E\%$ images were processed by programs developed at the K. M. Keck Center for Cellular Imaging, University of Virginia (Charlottesville). Bar, $10\mu \mathrm{m}$ .

3.6.

Interruption of ${\mathit{AT}}_{\mathit{1}}R$ Recycling by Rab4, Rab11 Gene Silencing

The ${\mathrm{AT}}_1\mathrm{R}$ recovery rate was markedly decreased in either Rab4 or Rab11 siRNA- treated cells (Fig. 2), which confirmed the conclusion obtained from the FRET studies that both Rab4 and Rab11 regulate the recycling of ${\mathrm{AT}}_1\mathrm{R}$ .

3.7.

Relationship of Rab4 and Rab11 During the Entire ${\mathit{AT}}_{\mathit{1}}R$ Recycling Course

In the basal state [Fig. 10a ] and the start of recycling, time 0 [Fig. 10b] no co-localization was observed between Rab4 and Rab11. At $15\min$ [Fig. 10c] and $45\min$ [Fig. 10d], obvious co-localization of Rab4 and Rab11 was observed, and the greatest co-localization occurred at time $45\min$ , predominantly at perinuclear compartments. At the late stage of the recycling period, co-localization was no longer observed [Figs. 10e and 10f].

Fig. 10

Dynamic relationship between Rab4 and Rab11 during the ${\mathrm{AT}}_1\mathrm{R}$ recycling course. At the basal state (a) and recycling time 0 (b), no co-localization exists between Rab4 and Rab11; at recycling time $15\min$ (c), a small portion of Rab11 is observed to co-localize with Rab4, and the calculated co-localization of Rab11 over Rab4 is $10.3\pm 1.4\%$ ; at the middle stage of recycling, time $45\min$ (d), obvious co-localization between Rab4 and Rab11 is observed in the perinuclear compartments and the cytoplasm, and the calculated overall co-localization of Rab4 over Rab11 is $34.1\pm 3.3\%$ ; at the late stage of recycling, times $2\mathrm{h}$ (e) and $3\mathrm{h}$ (f), no obvious co-localization is observed between Rab4 and Rab11. Red, Rab4; blue, Rab11; magenta, co-localization between Rab4 and Rab11. Data (mean $\pm$ SE) were from 24 to 65 cells per time point. Bar, $10\mu \mathrm{m}$ .